Preferred Name |
match to sequence model evidence |
|
Synonyms |
|
|
Definitions |
Used when evidence from any kind of statistical model of a sequence or group of sequences is used to make a prediction about the function of a protein or RNA. Examples of relevant evidence are: Hidden Markov Models, PROSITE motifs, and tools such as tRNASCAN. A type of sequence similarity evidence in which the function of a gene product is predicted based on a sequence-based statistical model. |
|
ID |
http://purl.obolibrary.org/obo/ECO_0000202 |
|
comment |
Used when evidence from any kind of statistical model of a sequence or group of sequences is used to make a prediction about the function of a protein or RNA. Examples of relevant evidence are: Hidden Markov Models, PROSITE motifs, and tools such as tRNASCAN. |
|
created_by |
mchibucos |
|
creation_date |
2010-03-18T12:32:30Z |
|
definition |
A type of sequence similarity evidence in which the function of a gene product is predicted based on a sequence-based statistical model. |
|
has_alternative_id |
ECO:00000063 |
|
has_obo_namespace |
eco |
|
IAO_0000112 |
A putative rho-independent terminator sequence (GCCTGACTACATAGATGTCAGGC) was identified at position 402-bp downstream of SMU.1882 by TransTerm (transterm.dev.java.net) program. |
|
id |
ECO:0000202 |
|
label |
match to sequence model evidence |
|
notation |
ECO:0000202 |
|
prefLabel |
match to sequence model evidence |
|
treeView | ||
subClassOf |